selectReference = '<h2>Select a Reference Genome</h2>Select a reference genome by clicking on one of the strains presented by this component\'s dropdown list.  The strains available for comparison can then be chosen.'
selectDataSets = '<h2>Select Data Sets</h2>Select one or more data sets from the list below.  The strains included in that data set will then be displayed.'
showAllReferenceStrains = '<h2>Show All Reference Strains</h2>If there is more than one reference strain for this release, include all reference strains on multiple alignments but compare selected strains only to the designated reference genome.'
useIntersectionQuery = '<h2>Intersection Query</h2>Show only polymorphisms that are identical in all strains selected from \'Mutations IN\'.'
minimumIdenticalMutations = '<h2>Only SNPS Shared in Minimum # of Strains</h2>Show only polymorphisms that occur in at least the selected number strains selected from \'Mutations IN\''
showUncalledRegions = '<h2>Show Uncalled Regions</h2>If this box is NOT checked, if any strain in a region is uncallable due to low coverage or other reason, none of the polymorphisms on ' +
		'any selected strain in the uncallable region will be included in the results of the query. <br>For example:<p>' +
		'<table><tr><td>Strain A</td><td>ATGCCTTCAGNNNNNCTACTCT</td></tr><tr><td>Strain B</td><td>ATGCCTTCAGCTATCCTACTCT</td></tr><tr><td>Reference</td><td>ATGCCTTCAGCTGTCCTACTCT</td></tr><tr><td></td><td>1234567890123456789012</td></tr></table>' +
		'<p>Although strain B is polymorphic with respect to the reference at coordinate 14,  unless the Show Uncalled Regions box is checked, the polymorphism will not be displayed on the Compare Strains Results page.  It will, however, be displayed on the Multiple Alignment Viewer if another SNP is selected in this region.'
flowcellMetrics = '<h2>Flowcell Metrics</h2>NOTE:  Most information from metrics file of a given flowcell lane: <br>PF: Pass Filter<br>Read Length:  from read_length metric<br>Total Reads:  from reads metric<br>Total Bases:  calculated from (Read Length * Total Reads)/1M<br>Total Cvg:  calculated from (Read Length * Total Reads)/genome_size<br>PF Reads:  are calculated from filter.vector file<br>(PF stands for Passing Filter which is an Illumina metric)<br>PF Bases:  are calculated from (Read Length * PF Reads)/1M<br>PF Cvg:  calculated from (Read Length * PF Reads)/genome_size<br>Aligned Reads:  from aligned_reads metrics<br>(best indication of quality; assuming reference is closely related)<br>Aligned Bases:  calculated from (Read Length * Aligned Reads)/1M<br>Aligned Cvg:  calculated from (Read Length * Aligned Reads)/genome_size<br>Pct. Aligned:  calculated from (Aligned Reads/Total Reads)* 100'
precomputedStrains = '<h2>Precomputed Strains</h2>Precomputed results for pairwise comparisons (Strain A \'IN\' vs Strain B \'NOT IN\') for all strains in this analysis run.  If strains are divided into datasets, only strains in the same dataset are compared to one another.  Results are calculated using the defaults for this site (Use Intersection Query, Do Not Show Frameshifted SNPs, etc.).'
changeReference = '<h2>Change Reference Strain</h2>Changing reference strain at this point will resubmit your previous query against the newly selected reference genome.'
showFrameshifted = "<h2>Show Frameshifted</h2>If any strain on this site has a mutation at a site that results in a frameshift in a coding region, that site is marked as 'frame shifted' for all strains.  " +
		"If this box is not checked, such sites will not be displayed for any strain on this site despite the fact that there are no frame shifts in some strains. "